View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9223_low_7 (Length: 531)

Name: NF9223_low_7
Description: NF9223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9223_low_7
NF9223_low_7
[»] chr4 (2 HSPs)
chr4 (6-73)||(11101280-11101347)
chr4 (474-517)||(11101344-11101387)


Alignment Details
Target: chr4 (Bit Score: 64; Significance: 1e-27; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 6 - 73
Target Start/End: Original strand, 11101280 - 11101347
Alignment:
6 agacataaattctattgataacgatcatcaaagcccttgctaccataacaaacaataagatataaaat 73  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
11101280 agacataaattctattgataacgatcgtcaaagcccttgctaccataacaaacaataagatataaaat 11101347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 474 - 517
Target Start/End: Original strand, 11101344 - 11101387
Alignment:
474 aaatgaatttttagagaaatagcaacaaggaccgtgttcatatc 517  Q
    ||||||||||||||||||||||||||||||||| ||||||||||    
11101344 aaatgaatttttagagaaatagcaacaaggaccttgttcatatc 11101387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University