View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9226_low_11 (Length: 508)
Name: NF9226_low_11
Description: NF9226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9226_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-134; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 17 - 263
Target Start/End: Complemental strand, 16762378 - 16762132
Alignment:
| Q |
17 |
gtgttcggtgattgtgtcagccgtcagtgtcgtgttcagtgtctatgtcatccgtaagtgtcgtgttcgatgtcggtgtcgtatttggtgcctgtgtcag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16762378 |
gtgttcggtgattgtgtcagccgtcagtgtcgtgttcagtgtctatgtcatccgtaagtgtcgtgttcgatgtcggtgtcgtatttggtgcctgtgtcag |
16762279 |
T |
|
| Q |
117 |
ctgttagtgtcgtgtccggtgtttgcagcaatatatgctatcaaattgaatccaataactaaaggagggaaaatgcactacttcaaacgagtgccacaac |
216 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16762278 |
ctgttagtgtcgtgttcggtgtttgcagcaatatatgctatcaaattgaatccaataactaaaggagggaaaatgcactacttcaaacgagtgccacaac |
16762179 |
T |
|
| Q |
217 |
ggtcataactgaattccactaacacgaattcaaatcctacattaacc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16762178 |
ggtcataactgaattccactaacacgaattcaaatcctacattaacc |
16762132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 386 - 489
Target Start/End: Complemental strand, 16762009 - 16761906
Alignment:
| Q |
386 |
gcaacgtagctcttcgaactaaaacccctacgaacttcctttcaaaccataacctaaatccacaatcggaaacctaatcgcaaagcgtgacgaagattca |
485 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16762009 |
gcaacgtagctcttcgaactaaaacccctacgaacttcctttcaaaccataacctaaatccacaatcggaaacctaatcgcaaagcgtgacgaagattca |
16761910 |
T |
|
| Q |
486 |
atct |
489 |
Q |
| |
|
|||| |
|
|
| T |
16761909 |
atct |
16761906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University