View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9226_low_32 (Length: 279)
Name: NF9226_low_32
Description: NF9226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9226_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 54504839 - 54504575
Alignment:
| Q |
1 |
atgaggaattggagttgatgaccaaggcgtgggtggtgaaggtggcggaggaggggaagaaagtatgggagctgccataacaacaacagctagctttaaa |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
54504839 |
atgaggaattggagttgatgaccgaggcgtgggtggtgaaggcggcggaggaggggaagaaagtacgggagctaccataacaacaacagctagctttaaa |
54504740 |
T |
|
| Q |
101 |
cccaacctgcaatgacgcttttttccacttatgaaatgatgtattcctgttttcttaagcaccaccattgtattgccgtcgtagtggtctacatgctctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54504739 |
cccaacctgcaatgacgcttttttccacttatgaaatgatgtattcctgttttcttaagcaccaccattgtattgccgtcgtagtggtctacatgctctc |
54504640 |
T |
|
| Q |
201 |
ctcttattctacatctatcatagtcttcctcttccacttcgtgtaccgattctgttttgttattg |
265 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54504639 |
ctcttattccacatctatcatagtcttcctcttccacttcgtgtaccgattctgttttgttattg |
54504575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 80 - 201
Target Start/End: Complemental strand, 54496660 - 54496539
Alignment:
| Q |
80 |
acaacaacagctagctttaaacccaacctgcaatgacgcttttttccacttatgaaatgatgtattcctgttttcttaagcaccaccattgtattgccgt |
179 |
Q |
| |
|
||||| ||||| |||||||| |||| | |||||||||||||| |||||||||||||||||| || |||| |||| | |||||| ||| | || ||||||| |
|
|
| T |
54496660 |
acaacgacagccagctttaatcccatcttgcaatgacgctttgttccacttatgaaatgatatactcctattttatcaagcacaaccttagtgttgccgt |
54496561 |
T |
|
| Q |
180 |
cgtagtggtctacatgctctcc |
201 |
Q |
| |
|
||| ||| || ||||| ||||| |
|
|
| T |
54496560 |
cgtggtgctccacatgttctcc |
54496539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University