View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9226_low_37 (Length: 241)
Name: NF9226_low_37
Description: NF9226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9226_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 14 - 225
Target Start/End: Complemental strand, 6340326 - 6340119
Alignment:
| Q |
14 |
gcagagatgtgtggcatttacatgtgatcattcaaattctataaagaaaaaccaacaaaattaaagtcttaattaaggttgttaccgctgtaacagccat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6340326 |
gcagagatgtgtggcatttacatgtgatcattcaaattctataaagaaaaaccaataaaattaaagtcttaa----ggttgttaccgctgtaacagccat |
6340231 |
T |
 |
| Q |
114 |
tgttattttgatctttgataacggttttggaactaaatgacatgaattttgaagagttgatatgtaattttgcacttcttgatcattgaaagaagtcttt |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6340230 |
tgttattttgatctttgataacgtttttggaactaaatgacatgaattttgaagagttgatatgtaattttgcacttcttgatcattgaaagaagtcttt |
6340131 |
T |
 |
| Q |
214 |
agtgctccatga |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6340130 |
agtgctccatga |
6340119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 136 - 204
Target Start/End: Complemental strand, 16170433 - 16170365
Alignment:
| Q |
136 |
ggttttggaactaaatgacatgaattttgaagagttgatatgtaattttgcacttcttgatcattgaaa |
204 |
Q |
| |
|
|||||||||||||||||||| ||||| | ||| |||| | || | ||| ||||||||||||||||||| |
|
|
| T |
16170433 |
ggttttggaactaaatgacacgaattctaaagtgttgttgagttaatttacacttcttgatcattgaaa |
16170365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University