View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9226_low_41 (Length: 223)
Name: NF9226_low_41
Description: NF9226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9226_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 16 - 200
Target Start/End: Complemental strand, 8441495 - 8441310
Alignment:
| Q |
16 |
ataatactgctattgaaaatataaggtttggttaggtcc-tatggtgttggaatcagcttttcaaccatttcatgctttggttgtcttttaacttgttga |
114 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8441495 |
ataacactgctgttgaaaatataaggtttggttaggtccctatggtgttggaatcaacttttcaaccatttcatgctttggttgtcttttaacttgttga |
8441396 |
T |
 |
| Q |
115 |
tcaaattatcatcattgagatcacttgtaattgtggtgaaaacgcgactgcagtaagatagaataaaaaagctgttggttagagat |
200 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8441395 |
tcaaattgacatcattgagatcacttgtagttgtggtcaaaacgcgactgcagtaagataaaataaaaaagctgttggttagagat |
8441310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 36 - 99
Target Start/End: Complemental strand, 8443242 - 8443177
Alignment:
| Q |
36 |
ataaggtttggttaggtcc-tatggtgttggaatcagctttt-caaccatttcatgctttggttgt |
99 |
Q |
| |
|
||||||||||| ||||||| |||| ||||| ||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
8443242 |
ataaggtttggctaggtccctatgatgttgaaatcagcttttgcaaccctttcatgctttggttgt |
8443177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University