View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9226_low_42 (Length: 223)

Name: NF9226_low_42
Description: NF9226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9226_low_42
NF9226_low_42
[»] chr1 (2 HSPs)
chr1 (16-200)||(8441310-8441495)
chr1 (36-99)||(8443177-8443242)


Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 16 - 200
Target Start/End: Complemental strand, 8441495 - 8441310
Alignment:
16 ataatactgctattgaaaatataaggtttggttaggtcc-tatggtgttggaatcagcttttcaaccatttcatgctttggttgtcttttaacttgttga 114  Q
    |||| |||||| ||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
8441495 ataacactgctgttgaaaatataaggtttggttaggtccctatggtgttggaatcaacttttcaaccatttcatgctttggttgtcttttaacttgttga 8441396  T
115 tcaaattatcatcattgagatcacttgtaattgtggtgaaaacgcgactgcagtaagatagaataaaaaagctgttggttagagat 200  Q
    |||||||  |||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||||||||||||||||||||||    
8441395 tcaaattgacatcattgagatcacttgtagttgtggtcaaaacgcgactgcagtaagataaaataaaaaagctgttggttagagat 8441310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 36 - 99
Target Start/End: Complemental strand, 8443242 - 8443177
Alignment:
36 ataaggtttggttaggtcc-tatggtgttggaatcagctttt-caaccatttcatgctttggttgt 99  Q
    ||||||||||| ||||||| |||| ||||| ||||||||||| ||||| |||||||||||||||||    
8443242 ataaggtttggctaggtccctatgatgttgaaatcagcttttgcaaccctttcatgctttggttgt 8443177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University