View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9226_low_6 (Length: 718)
Name: NF9226_low_6
Description: NF9226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9226_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 3e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 3e-68
Query Start/End: Original strand, 13 - 148
Target Start/End: Complemental strand, 12830545 - 12830410
Alignment:
| Q |
13 |
attatacttgtcacttttattcattaatatttgtaagaattttgtccttttattctattaacttgcaacataatcattttcggttttagtgatattaaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12830545 |
attatacttgtcacttttattcattaatatttgtaagaattttgtccttttattctattaacttgcaaaataatcattttcggttttagtgatattaaat |
12830446 |
T |
|
| Q |
113 |
ttgtagtgttcatattagtgatacttgcctcaaggt |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
12830445 |
ttgtagtgttcatattagtgatacttgcctcaaggt |
12830410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 619 - 695
Target Start/End: Complemental strand, 12828232 - 12828156
Alignment:
| Q |
619 |
ggtttcgccttcatgctactgagccgactgggtctctttttgtcatcacttgttgggaaatttggaaacctaggaac |
695 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12828232 |
ggtttcgccttcatgctactgggccgactgggtctctttttgtcatcacttgttgggaaatttggaaagctaggaac |
12828156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University