View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9228_high_4 (Length: 227)
Name: NF9228_high_4
Description: NF9228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9228_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 34484791 - 34484582
Alignment:
| Q |
1 |
ttatggagcaaagcattttagcctgttcnnnnnnnnnnnttattgagcaaaggatcaatggaat-agttgagaagttgaacaagaattaatataggaggt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34484791 |
ttatggagcaaagcattttagcctgttcaaaaaaaaaaattattgagcaaaggatcaatggaatgagttgagaagttgaacaagaattaatataggaggt |
34484692 |
T |
 |
| Q |
100 |
gaattatttgatatcagttgttaacaaatacctctctcttaactattattcactgacatttgtgaattaaaaatggaataaaagtctaaccagttttgac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34484691 |
gaattatttgatatcagttgttaacaaatacctctctcttaactattattcactgacatttgtgaattaaaaatggaataaaagtctaaccagttttgac |
34484592 |
T |
 |
| Q |
200 |
tatgagattc |
209 |
Q |
| |
|
|||||||||| |
|
|
| T |
34484591 |
tatgagattc |
34484582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 65 - 160
Target Start/End: Complemental strand, 34490126 - 34490030
Alignment:
| Q |
65 |
agttgagaagttgaacaagaattaatataggaggtgaattatttgatatcagttgttaacaa-atacctctctcttaactattattcactgacattt |
160 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||| | || ||||||| |
|
|
| T |
34490126 |
agttgagacgtttaacaagaattaatataggaggtgaattatttgatatcagttgttaacaacatacatctctcttaacaattaattacggacattt |
34490030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University