View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9228_low_13 (Length: 217)

Name: NF9228_low_13
Description: NF9228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9228_low_13
NF9228_low_13
[»] chr1 (1 HSPs)
chr1 (10-199)||(36754576-36754765)


Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 10 - 199
Target Start/End: Complemental strand, 36754765 - 36754576
Alignment:
10 gtttggtgttgcatctgaacttgagtaactctctcataagctaagtcaaccataacttcagtctttaagttcttgaactcagaaggatacacatattcaa 109  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36754765 gtttggggttgcatctgaacttgagtaactctctcataagctaagtcaaccataacttcagtctttaagttcttgaactcagaaggatacacatattcaa 36754666  T
110 aggatgcaagagcagtaatcgacatgtcttctactctgagaggggtcaatgaaacatcaggtgccacaactggaaaatcatatacttcat 199  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36754665 aggatgcaagagcagtaatcgacatatcttctactctgagaggggtcaatgaaacatcaggtgccacaactggaaaatcatatacttcat 36754576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University