View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9229_low_10 (Length: 240)
Name: NF9229_low_10
Description: NF9229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9229_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 77 - 223
Target Start/End: Complemental strand, 13366543 - 13366397
Alignment:
| Q |
77 |
gtaacaataggaaagggagaaacaataggacaaatacacaataaggacaatttgagcaccacaaaaatattagatattttaattacgggaagggttcaat |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13366543 |
gtaacaataggaaagggagaaacaataggacaaatacacaaaaaggacaatttgagcaccacaaaaatattagatattttaattacgggaagggttcaat |
13366444 |
T |
|
| Q |
177 |
tttcttttcttattagttgtagggaatgcttcttttgcctccaattt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13366443 |
tttcttttcttattagttgtagggaatgcttcttttgcctccaattt |
13366397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 13366619 - 13366572
Alignment:
| Q |
1 |
attaggcaatcctcttacacttcttctgcaagtggaaacaatgcaagg |
48 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13366619 |
attaggcaatcctcttacgcttcttctgcaagtggaaacaatgcaagg |
13366572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University