View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9229_low_11 (Length: 232)
Name: NF9229_low_11
Description: NF9229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9229_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 11 - 196
Target Start/End: Original strand, 8830848 - 8831026
Alignment:
| Q |
11 |
agcagagaaggagtggacggcatagacaaagtgaaggagaaggtgtgggatgacatgattgtggttcgaagaaggaggaggagaagcctgtgaagtgtga |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8830848 |
agcatagaaggagtggacggcatagacacagtgaaggagaaggtgtgggatgacatgattgtggttcgaagaaggaggaggagaagcctgcgaagtgtga |
8830947 |
T |
|
| Q |
111 |
ggattttgtttttgttaagacgcatattacttacattaggcagtaccttttaaggaaacgaatctcctcaggtgggtgggttcata |
196 |
Q |
| |
|
|| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8830948 |
ggtttttgtttttgttaagacacatattacttacattaggcag-------taaggaaacgaatctcctcaggtgggtgggttcata |
8831026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 91
Target Start/End: Original strand, 43985044 - 43985092
Alignment:
| Q |
43 |
gaaggagaaggtgtgggatgacatgattgtggttcgaagaaggaggagg |
91 |
Q |
| |
|
||||||||||| ||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
43985044 |
gaaggagaaggcgtgggatgacatgatcatgggtcgaagaaggaggagg |
43985092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University