View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9230_low_9 (Length: 247)
Name: NF9230_low_9
Description: NF9230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9230_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 36994144 - 36993960
Alignment:
| Q |
1 |
agagatggcaacccaaaagaaagaagaaagggttaaccaggctgagcttgataaagaggcggcgcgtgaacacaacgctgcaacttctgccgggcaccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36994144 |
agagatggcaacccaaaagaaagaagaaagggttaaccaggctgagcttgataaagaggcggcgcgtgaacacaacgctgcagcttctgccgggcaccaa |
36994045 |
T |
|
| Q |
101 |
ttgggggtgggtggacaccacaccacaggaactggtggggctgctcaaaatagggcatagtttgggctgtgagtcactgggtatg |
185 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36994044 |
ttgggggtgggtggacaccacaccacgggaactggtggggctgctcaaaatagggcatagtttgggctgtgagtcactgggtatg |
36993960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 2 - 179
Target Start/End: Complemental strand, 36988368 - 36988191
Alignment:
| Q |
2 |
gagatggcaacccaaaagaaagaagaaagggttaaccaggctgagcttgataaagaggcggcgcgtgaacacaacgctgcaacttctgccgggcaccaat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||| |
|
|
| T |
36988368 |
gagatggcaacccaaaagaaagaagaaagggttaaccaggctgaacttgataaagaggcggcgcgtgaacacaacgctgcagccaccaccgggcaccaat |
36988269 |
T |
|
| Q |
102 |
tgggggtgggtggacaccacaccacaggaactggtggggctgctcaaaatagggcatagtttgggctgtgagtcactg |
179 |
Q |
| |
|
||||| |||||||||||| ||| | |||||||||||||||||||||| ||| | ||||||||||||||||||||| |
|
|
| T |
36988268 |
tggggcagggtggacaccatacctcgggaactggtggggctgctcaaacgaggagacagtttgggctgtgagtcactg |
36988191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 36993796 - 36993751
Alignment:
| Q |
186 |
gaactgggggtacacttaccgttaagttacagtagtaatacttatt |
231 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36993796 |
gaactgggggtacactcaccgttaagttacagtagtaatacttatt |
36993751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University