View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9231_low_21 (Length: 375)
Name: NF9231_low_21
Description: NF9231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9231_low_21 |
 |  |
|
| [»] scaffold0108 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0108 (Bit Score: 84; Significance: 8e-40; HSPs: 2)
Name: scaffold0108
Description:
Target: scaffold0108; HSP #1
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 109 - 192
Target Start/End: Original strand, 14228 - 14311
Alignment:
| Q |
109 |
ccccttcatgtgcataatttttccttttccatgatatactttaaccctctcttagcttatatataaacaaaattatattaatga |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14228 |
ccccttcatgtgcataatttttccttttccatgatatactttaaccctctcttagcttatatataaacaaaattatattaatga |
14311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0108; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 275 - 324
Target Start/End: Original strand, 14396 - 14445
Alignment:
| Q |
275 |
gaatgaatgaacgagattattattgacaaaagaaatatttaatgtaacat |
324 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14396 |
gaatgaatgaccgagattattattgacaaaagaaatatttaatgtaacat |
14445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University