View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9231_low_35 (Length: 242)
Name: NF9231_low_35
Description: NF9231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9231_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 34532281 - 34532176
Alignment:
| Q |
1 |
tgcaatgttttgaaattcggaccgaatatggacc-agtgaaacttcaagattatgatttaataggttcaatcagttcaacttcggttaaactggatgaca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
34532281 |
tgcaatgttttgaaattcggaccgaatatggaactagtgaaacttcaagattatgatttaataggttcaatcagttcaactacggttaaactggacgaca |
34532182 |
T |
 |
| Q |
100 |
gataga |
105 |
Q |
| |
|
|||||| |
|
|
| T |
34532181 |
gataga |
34532176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 148 - 228
Target Start/End: Complemental strand, 34532133 - 34532053
Alignment:
| Q |
148 |
ctagctacgattaaaccgtagttaagaggtttgacccgattcaatatggttcaaccagactgcaatatagagaaccaacct |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34532133 |
ctagctacgattaaaccgtagttaagaggtttgacccgattcaatatggttcaaccagactgcaatatagagaaccaacct |
34532053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University