View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9238_low_13 (Length: 407)
Name: NF9238_low_13
Description: NF9238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9238_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 2e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 272 - 381
Target Start/End: Original strand, 8143197 - 8143306
Alignment:
| Q |
272 |
ctccacattggcacaacttttcacttcaaagtgtgcaccatacgcgcttctcttgcgtggggctcataacacaaaagcctttttccttgcttttcctcac |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8143197 |
ctccacattggcacaacttttcacttcaaagtgtgcaccatacgtgcttctcttgcgtggggctcatatcacaaaagcctttttccttgcttttcctcac |
8143296 |
T |
 |
| Q |
372 |
tctttgtaga |
381 |
Q |
| |
|
|||||||||| |
|
|
| T |
8143297 |
tctttgtaga |
8143306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 20 - 233
Target Start/End: Original strand, 8142948 - 8143159
Alignment:
| Q |
20 |
tgaagccccaataccttaaaaatggtaaagtatcatgtccaacatgcatctgataccgatattgatacgtggctgatataaattaaggaagtatcgaaca |
119 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||| ||||||||||| |||| ||||| | |||| |||||||| || |||||||| ||| |
|
|
| T |
8142948 |
tgaagcctcaatacctttaaaatggtaaagtatcatgtccaacgcgcatctgatactgatactgatatgcggctaatataaatcaatgaagtatcagaca |
8143047 |
T |
 |
| Q |
120 |
attaattttannnnnnnnggnnnnnnnntgtctgatatctttacgacacagttgtcttgtagtcctaatacaacttattagtctgatatgtactccggag |
219 |
Q |
| |
|
|||||||||| | |||||||||||||||| |||| ||||||||||| ||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
8143048 |
attaattttattttttt--ggaaaaaaatgtctgatatctttactacacggttgtcttgtacccctaatacaacttatgagtctgatatgtactcccgag |
8143145 |
T |
 |
| Q |
220 |
atgtttgtgtatcc |
233 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
8143146 |
atgtttgtgaatcc |
8143159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University