View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9238_low_6 (Length: 460)
Name: NF9238_low_6
Description: NF9238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9238_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 358; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 22 - 447
Target Start/End: Original strand, 16910469 - 16910894
Alignment:
| Q |
22 |
aatcaatttctttacaagatattgttttaagaaatgaaggaggcgttgaacctgaacttgtggacatggtcatgaaatatgcgatgtcacataatgtcga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
16910469 |
aatcaatttctttacaagatattgttttaagaaatgaaagaggcgttgaacctaaacttgtggacgcggtcatgaaatatgctatgtcacataatgtcga |
16910568 |
T |
 |
| Q |
122 |
gaatttcactcttgaactttatttgaatttcaaacccggttacattttgcgccctagcatcttttcttgcaaatctttgacacatctaaagcttttattt |
221 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16910569 |
gaatttcacacttgaactttatttgaatttcaaacccggttacactttgcgccctagcatcttttcttgcaaatctttgacacatctaaagcttttattt |
16910668 |
T |
 |
| Q |
222 |
tggggtgtccgttggatgatgaaaattccaacttccttggaattgcctgctttgaaaagcttgcatcttatctctgtcacttttgttgcaaatgataatg |
321 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
16910669 |
tggggtgtcccttggatgatgaaaattccaacttccttggaattgcctgctttgaaaagcttgcatcttatctctgccacttttgttgcaaatgacaatg |
16910768 |
T |
 |
| Q |
322 |
gcattgtggaacccttttcaaattttaagatgttaagcaccttggttcttgactgttggtgtctacaacacaatgcaactgtcctctgcatatctaattc |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16910769 |
gcattgtggaacccttttcaaattttaagatgttaagcactttggtccttaactgttggtctctacaacacaatgcaactgtcctctgcatatctaattc |
16910868 |
T |
 |
| Q |
422 |
caagctatatagtttgtccacaggtt |
447 |
Q |
| |
|
|||||||| |||||||| || ||||| |
|
|
| T |
16910869 |
caagctatctagtttgtgcataggtt |
16910894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 123 - 216
Target Start/End: Complemental strand, 50790383 - 50790290
Alignment:
| Q |
123 |
aatttcactcttgaactttatttgaatttcaaacccggttacattttgcgccctagcatcttttcttgcaaatctttgacacatctaaagcttt |
216 |
Q |
| |
|
||||| ||||||||| || ||| |||||| || | |||||||| |||| |||||||||||||||||| ||||||||||| ||| ||||||| |
|
|
| T |
50790383 |
aatttaactcttgaagttgattcgaattttaagcgcggttacacattgcaccctagcatcttttcttgtcaatctttgacatgtcttaagcttt |
50790290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University