View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9239_low_14 (Length: 548)
Name: NF9239_low_14
Description: NF9239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9239_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 500; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 500; E-Value: 0
Query Start/End: Original strand, 18 - 529
Target Start/End: Complemental strand, 40383480 - 40382969
Alignment:
| Q |
18 |
aaattagtctcaggaactaatggtggtaatggaaacggtaactcaattgcgtcctcagttgccacttttgcaaatccgttttggattgaaatggcagtta |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40383480 |
aaattagtctcaggaactaacggtggtaatggcaacggtaactcaattgcgtcctcagttgccacttttgcaaatccgttttggattgaaatggcggtta |
40383381 |
T |
 |
| Q |
118 |
ttggaaaacggtctctactaaactcaagacggatgccggaattattcggaatccgtctcggtgcagttctggttaccggaggaatcttggccaccatctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383380 |
ttggaaaacggtctctactaaactcaagacggatgccggaattattcggaatccgtctcggtgcagttctggttaccggaggaatcttggccaccatctt |
40383281 |
T |
 |
| Q |
218 |
ttaccgtcttgacgattcaccaaaaggtgttcaagagcgtttgggtttcttcgcctttgccatgtcaacaaccttctacacttgtgctgaagctatcccc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383280 |
ttaccgtcttgacgattcaccaaaaggtgttcaagagcgtttgggtttcttcgcctttgccatgtcaacaaccttctacacttgtgctgaagctatcccc |
40383181 |
T |
 |
| Q |
318 |
gttttccttcaagagcgttacattttcatgagagaaactgcttacaacgcttaccgtcgttcttcctatgtccttgcacactccatcatctctctccctg |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383180 |
gttttccttcaagagcgttacattttcatgagagaaactgcttacaacgcttaccgtcgttcttcctatgtccttgcacactccatcatctctctccctg |
40383081 |
T |
 |
| Q |
418 |
cactcatcttcctctccttcgccttctccgtcaccactttttggtctgttggacttgccggcgggacatctggtttcctcttttactttttcaccatttt |
517 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383080 |
cactcatcttcctctccttcgccttctccgtcaccactttttggtctgttggacttgccggcgggacatctggtttcctcttttactttttcaccatttt |
40382981 |
T |
 |
| Q |
518 |
agcttccttctg |
529 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40382980 |
agcttccttctg |
40382969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University