View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9239_low_30 (Length: 236)
Name: NF9239_low_30
Description: NF9239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9239_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 13908423 - 13908511
Alignment:
| Q |
1 |
gtataagttgaagtttacgtaaagtgatattattatttttaatatcactttaaattttaatgaagaatgacatttttggataatgtgta |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13908423 |
gtataagttgaagtttacgtaaagtgatattattatttttaatatcactttaaattttaatgaagaatgacatttttggataatgtgta |
13908511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 165 - 220
Target Start/End: Original strand, 13908587 - 13908642
Alignment:
| Q |
165 |
taggataatgtctaacaaaagatatgtctggtacattagcaagtagtatgaaagat |
220 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13908587 |
taggataatgtctaacaaaagatacgtctggtacattagcaagtagtatgaaagat |
13908642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University