View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9239_low_32 (Length: 236)

Name: NF9239_low_32
Description: NF9239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9239_low_32
NF9239_low_32
[»] chr8 (2 HSPs)
chr8 (1-89)||(13908423-13908511)
chr8 (165-220)||(13908587-13908642)


Alignment Details
Target: chr8 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 13908423 - 13908511
Alignment:
1 gtataagttgaagtttacgtaaagtgatattattatttttaatatcactttaaattttaatgaagaatgacatttttggataatgtgta 89  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13908423 gtataagttgaagtttacgtaaagtgatattattatttttaatatcactttaaattttaatgaagaatgacatttttggataatgtgta 13908511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 165 - 220
Target Start/End: Original strand, 13908587 - 13908642
Alignment:
165 taggataatgtctaacaaaagatatgtctggtacattagcaagtagtatgaaagat 220  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
13908587 taggataatgtctaacaaaagatacgtctggtacattagcaagtagtatgaaagat 13908642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University