View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9240_high_15 (Length: 214)
Name: NF9240_high_15
Description: NF9240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9240_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 4 - 194
Target Start/End: Original strand, 32412091 - 32412279
Alignment:
| Q |
4 |
gtgtatatcatcgtgcaaaacaaggcataagggctgccggaagaaaatgtctaacaacagtagttttaatannnnnnnngttaaatagtttagggtttag |
103 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
32412091 |
gtgtacatcatcgtgcaaaacaaggcacaagggctgccggaagaaaatgtcta-caacagtagttataatattttttt-gttaaatagtttagggtttag |
32412188 |
T |
 |
| Q |
104 |
atatttacctcttaagctaaatcagaaatttgagttttaaaccctaacttatgcatagtataacttttttgtcaagtagcatagtgcctaa |
194 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
32412189 |
atatttaccccttaagctgaatcggaaatttgagttttaaaccctaacttatgcatattataatttttttgtcaagtagcatagtgcctaa |
32412279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University