View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9240_high_5 (Length: 384)
Name: NF9240_high_5
Description: NF9240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9240_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 218 - 367
Target Start/End: Complemental strand, 7548334 - 7548185
Alignment:
| Q |
218 |
agatctcgacgtttgcattattgttgattgagtttaaagaaatatttttgttgtggtgaattttgattgaagttgcaaagatttgattaaaaaatagtga |
317 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7548334 |
agatctcgacgtttgcattactgttgattgagtttaaagaaatatttttgttgtggtgaattttgattgaagttgcaaagatttgattaaaaaatagtga |
7548235 |
T |
|
| Q |
318 |
gctatgacaagtttgtctaattgttggttggttttttaaacatgagtttt |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7548234 |
gctatgacaagtttgtctaattgttggttggttttttaaacatgagtttt |
7548185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 13 - 158
Target Start/End: Complemental strand, 7548627 - 7548482
Alignment:
| Q |
13 |
attatacttgaaactttctgcccatggcagctacaatgtttcacctaaattcttggttttaaaagttcacaccttgtgactttgtttggagttgacagtc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7548627 |
attatacttgaaactttctgcccatggcagctacaatgtttcacctaaattcttggttttaaaagttcacaccttgtgactttgtttggagttgacagtc |
7548528 |
T |
|
| Q |
113 |
atggaagtcggattataaaagttcattatgtttttaaaatcttaca |
158 |
Q |
| |
|
|| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7548527 |
atagaagtcggattgcaaaagttcattatgtttttaaaatcttaca |
7548482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University