View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9240_low_8 (Length: 517)
Name: NF9240_low_8
Description: NF9240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9240_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 256 - 498
Target Start/End: Complemental strand, 17724777 - 17724535
Alignment:
| Q |
256 |
tctagatatttccgcaaccatcaacacgttgcatttgccttaatcaacgaacgcatcttccgccgaaataaccgatcctttttatatacaacagtttcac |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17724777 |
tctagatatttccgcaaccatcaacacgttgcatttgccttaatcaacgaacgcatcttctgccgaaataaccgatcctttttatatacaacagtttcac |
17724678 |
T |
|
| Q |
356 |
cggttcggttcggttcaccggttcaactaactcacggttgacgttgagaatcacttctccaaaacccggttcccgcaaaccgtgcccacatctccttctc |
455 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17724677 |
cggttcggtttggttcaccggttcaactaactcacggttgacgttgagaatcacttctccaaaacccggttcccgcaaaccgtgcccacatctccttctc |
17724578 |
T |
|
| Q |
456 |
caacgcaacctcctccgatttctcctccgccgcacgttccttc |
498 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17724577 |
caacgcaacctcctccgatttctcctccgccgcacgttccttc |
17724535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 28 - 154
Target Start/End: Complemental strand, 17725006 - 17724880
Alignment:
| Q |
28 |
ccacaccaatcaacataaatcaattcaacagttctttcatgtcgaccaaaattatgcaatgatccaaacagaaaaattgattatcaagcatcatgagaat |
127 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
17725006 |
ccacaccaatcaacatatatcaattcaacagttcttccatgtcgaccaaaattatgcaatgatccaaacacaaaaattgacaatcaagcatcatgagaat |
17724907 |
T |
|
| Q |
128 |
gttgcactacattccaaaattttacat |
154 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
17724906 |
gttgcactacattccaaaattttacat |
17724880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University