View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9241_low_32 (Length: 307)
Name: NF9241_low_32
Description: NF9241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9241_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 51 - 291
Target Start/End: Original strand, 45039480 - 45039723
Alignment:
| Q |
51 |
cttgtcaagaaatagtaaaataaataggatcagttctgataaannnnnnngcatagactaccaagtctttgcaatcacatt----tcaataaaaataaaa |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45039480 |
cttgtcaagaaatagtaaaataaataggatcagttctgataa-tttttttgcatagactaccaagtctttgcaatcacattaatttcaataaaaataaaa |
45039578 |
T |
|
| Q |
147 |
acatttccagacagagaacaacaaaaggaagttttcattttcttgcatcttttaccatgattttgaatcacgatattctagcataaccagtttatcaaag |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45039579 |
acatttccagacagagaacaacaaaaggaagttttcattttcttgcatcttttaccatgattttgaatcacgatattctagcataaccagtttatcaaag |
45039678 |
T |
|
| Q |
247 |
gatcacaaatgaggctacaaagttaaatgaataccaattgctgct |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45039679 |
gatcacaaatgaggctacaaagttaaatgaatactaattgctgct |
45039723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 185 - 233
Target Start/End: Original strand, 45042943 - 45042991
Alignment:
| Q |
185 |
tttcttgcatcttttaccatgattttgaatcacgatattctagcataac |
233 |
Q |
| |
|
|||||||||| |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
45042943 |
tttcttgcatattttaccatgtttgtgaatcacgatattctagcataac |
45042991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 189 - 232
Target Start/End: Complemental strand, 38346867 - 38346824
Alignment:
| Q |
189 |
ttgcatcttttaccatgattttgaatcacgatattctagcataa |
232 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38346867 |
ttgcatcttttaccatgattgtgaatcacgatattctagcataa |
38346824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University