View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9241_low_38 (Length: 267)
Name: NF9241_low_38
Description: NF9241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9241_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 8 - 248
Target Start/End: Original strand, 46843158 - 46843398
Alignment:
| Q |
8 |
cagagaaatagataggtttctgtttctattcatggaaacttattttcagttcatgttttctagctttcagtagaatgcatgtttctaaatttttgctata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46843158 |
cagagaaatagataggtttctgtttctattcatggaaacttattttcagttcatgttttctagctttcagtagaatgcatgtttctaaatttctgctata |
46843257 |
T |
 |
| Q |
108 |
ttcttgttttatgtgttgtgtttgtttcacagtttgtgactaagctactactataatggaagattctagttcaaagaaaatcacttcatccttcttcaat |
207 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46843258 |
ttcttgttttatgtgttgtttttgtttcacagtttgtgactaagctactactataatggaagattctagttcaaagaaaatcacttcatccttcttcaat |
46843357 |
T |
 |
| Q |
208 |
tctccaaagttgttcacatcaaaaggttttcatgaaactga |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46843358 |
tctccaaagttgttcacatcaaaaggttttcatgaaactga |
46843398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University