View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9241_low_39 (Length: 266)
Name: NF9241_low_39
Description: NF9241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9241_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 12 - 115
Target Start/End: Original strand, 14375846 - 14375949
Alignment:
| Q |
12 |
tgaaatggttacttttaattctctaactccttcaactaaccgatacaattatcagtaactcactcactctattatcaatacttttacggacaaaacatac |
111 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||| | |||||||||| || |
|
|
| T |
14375846 |
tgaaatggttactcttaaatctctaactcctttaactaacaaataaaattatcagtaactcactcactctattatcaatactttcatggacaaaacacac |
14375945 |
T |
 |
| Q |
112 |
acta |
115 |
Q |
| |
|
|||| |
|
|
| T |
14375946 |
acta |
14375949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 35 - 76
Target Start/End: Complemental strand, 32970762 - 32970721
Alignment:
| Q |
35 |
taactccttcaactaaccgatacaattatcagtaactcactc |
76 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||||||||||| |
|
|
| T |
32970762 |
taactccttcaattaacccataaaattatcagtaactcactc |
32970721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University