View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9241_low_42 (Length: 240)
Name: NF9241_low_42
Description: NF9241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9241_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 219
Target Start/End: Complemental strand, 55378113 - 55377905
Alignment:
| Q |
12 |
gatgaacatcatatatcacttgaagcaatggtggaatttcttaatctaatgatgaaatcaaacttgtgatcgtaaatgatacaacatctagttcaactgt |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55378113 |
gatggacatcatatatcacttgaagcaatggtggaatttcttaatctaatgatgaaatcaaacttgtgatcgtaaatgatacaacatctagttcaactgt |
55378014 |
T |
 |
| Q |
112 |
gtacactatactataactagatatt-ttttagtataacaatgttacttgaaatctaaaatccgatagcatataaaaatacatgacatatagctattgatt |
210 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55378013 |
gtacactatactataactagatatttttttagtataacaatgttacttgaaatctaaaatccgatagcatataaaaatacatgacatatagctattgatt |
55377914 |
T |
 |
| Q |
211 |
taaaagaga |
219 |
Q |
| |
|
||||||||| |
|
|
| T |
55377913 |
taaaagaga |
55377905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University