View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9241_low_46 (Length: 227)
Name: NF9241_low_46
Description: NF9241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9241_low_46 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 27936668 - 27936442
Alignment:
| Q |
1 |
catggactctactggatcattcaaatctggcaaagtggaagtagcagtagaattattcgtatcttgtaaaggccgaaggttttctaagaacatccaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27936668 |
catggactctactggatcattcaaatctggcaaagtggaagtagcagtagaattattcgtatcttgtaaaggccgaaggttttctaagaacatccaattt |
27936569 |
T |
|
| Q |
101 |
gatcttgattcttttttaactgggagattttcaattatctctacgtcatctgaatcatctgatgtacgacttgatgtatctagagatgactcagccttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27936568 |
gatcttgattcttttttaactgggagattttcaattatctctacgtcatctgaatcatctgatgtacgacttgatgtatctagagatgactcagccttta |
27936469 |
T |
|
| Q |
201 |
catgctctgcttgtagatgtgcattga |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
27936468 |
catgctctgcttgtagatgtgcattga |
27936442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 72 - 209
Target Start/End: Original strand, 27917254 - 27917389
Alignment:
| Q |
72 |
gccgaaggttttctaagaacatccaatttgatcttgattcttttttaactgggagattttcaattatctctacgtcatctgaatcatctgatgtacgact |
171 |
Q |
| |
|
||||||||||||||| | ||||||||| |||| ||||| ||||||||| || || ||||||||| | |||| || || ||||||||| ||||||| | |
|
|
| T |
27917254 |
gccgaaggttttctatggacatccaatgtgatattgatacttttttaattgtgaaattttcaat--tttctatgtgatttgaatcatccgatgtactgca |
27917351 |
T |
|
| Q |
172 |
tgatgtatctagagatgactcagcctttacatgctctg |
209 |
Q |
| |
|
|||||||||||||||||| | || |||||||| ||||| |
|
|
| T |
27917352 |
tgatgtatctagagatgatttagtctttacattctctg |
27917389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University