View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9242_low_15 (Length: 241)
Name: NF9242_low_15
Description: NF9242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9242_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 20660719 - 20660486
Alignment:
| Q |
1 |
ttaggttggacattatctgtggttgtgtgtgagtttttaggtgatgctaaccactttgtctacgtacaacnnnnnnncattttggatgcttactatttag |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20660719 |
ttaggttggacattatctgttgttgtgtgtgagtttttaggtgatgctaaccactttgtctacgtacaacaaaaaaacattttggatgcttactatttag |
20660620 |
T |
|
| Q |
101 |
ttagtttatgatattatagattttgaaacaactgaaaattcaagctatatttttgtgaggttggtttcattttgttgctaaacttttaagaatgacctat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20660619 |
ttagtttatgatattatagattttgaaacaactgaaaattcaagctatatttttgtgaggttggtttcattctgttgctaaacttttaagaatgacctat |
20660520 |
T |
|
| Q |
201 |
gagacagacgggtatgtgtttttcataactttgt |
234 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
20660519 |
gagacagaccggtatgtgtttttcataactttgt |
20660486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 83 - 176
Target Start/End: Complemental strand, 20630957 - 20630866
Alignment:
| Q |
83 |
tggatgcttactatttagttagtttatgatattatagattttgaaacaactgaaaattcaagctatatttttgtgaggttggtttcattttgtt |
176 |
Q |
| |
|
|||||||||||||| | |||||||||||||| ||||||||||| | ||||||||||||||||| || ||||||| ||||| ||||||| |||| |
|
|
| T |
20630957 |
tggatgcttactat--acttagtttatgatataatagattttgatataactgaaaattcaagctgtacttttgtggggttgatttcattctgtt |
20630866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 84 - 176
Target Start/End: Original strand, 12053565 - 12053655
Alignment:
| Q |
84 |
ggatgcttactatttagttagtttatgatattatagattttgaaacaactgaaaattcaagctatatttttgtgaggttggtttcattttgtt |
176 |
Q |
| |
|
||||||||||||| | |||||||||||||| ||||||||||| | ||||||||||||||||| || ||||||| ||||| ||||||| |||| |
|
|
| T |
12053565 |
ggatgcttactat--acttagtttatgatataatagattttgagataactgaaaattcaagctgtacttttgtggggttgatttcattctgtt |
12053655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 148 - 223
Target Start/End: Complemental strand, 20598371 - 20598291
Alignment:
| Q |
148 |
tatttttgtgaggttggtttcatt-----ttgttgctaaacttttaagaatgacctatgagacagacgggtatgtgttttt |
223 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||| ||||||| ||||| |
|
|
| T |
20598371 |
tatttttgtgaggttgatttcattatgttttgttgctaaacttttaagaatgatgtatgagacagattggtatgtcttttt |
20598291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 129
Target Start/End: Complemental strand, 20607516 - 20607464
Alignment:
| Q |
78 |
cattttggatgcttacta-tttagttagtttatgatattatagattttgaaac |
129 |
Q |
| |
|
|||||||||||||||||| |||||| | ||||||||| ||||||||||||||| |
|
|
| T |
20607516 |
cattttggatgcttactactttagtcactttatgataatatagattttgaaac |
20607464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 208
Target Start/End: Complemental strand, 20607461 - 20607396
Alignment:
| Q |
148 |
tatttttgtgaggttggtttcatt-----ttgttgctaaacttttaagaatgacctatgagacaga |
208 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||||| || |||||||| |
|
|
| T |
20607461 |
tatttttgtgaggttgatttcattatgttttgttgctaaacttttaagaatgatgtacgagacaga |
20607396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University