View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9243_high_9 (Length: 321)

Name: NF9243_high_9
Description: NF9243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9243_high_9
NF9243_high_9
[»] chr3 (2 HSPs)
chr3 (8-187)||(10538515-10538694)
chr3 (8-187)||(10683199-10683378)


Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 8 - 187
Target Start/End: Complemental strand, 10538694 - 10538515
Alignment:
8 gagaagcagagattgtaatattatactttggactcaatggagagacccctctgtcttttgaagagataggaaagttgttgaaactatcaagggagagaat 107  Q
    |||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |||||||||||||||| ||||||||    
10538694 gagaagaagagattgtaagattatactttggactcaatggagagacccctttgtcttttgaggagataggaaagctgttgaaactatcaagagagagaat 10538595  T
108 cagacagattcatggcattgcattgtcaaaattgcaacaaaattcacttgtaaatagtctaaagttttatgttgtataga 187  Q
    ||||||||||||||||||||||||||||||||||| ||||||| |  ||||| |||||||||||||||||||||| ||||    
10538594 cagacagattcatggcattgcattgtcaaaattgcgacaaaatactattgtagatagtctaaagttttatgttgtttaga 10538515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 8 - 187
Target Start/End: Complemental strand, 10683378 - 10683199
Alignment:
8 gagaagcagagattgtaatattatactttggactcaatggagagacccctctgtcttttgaagagataggaaagttgttgaaactatcaagggagagaat 107  Q
    |||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |||||||||||||||| ||||| ||    
10683378 gagaagaagagattgtaagattatactttggactcaatggagagacccctttgtcttttgaggagataggaaagctgttgaaactatcaagagagaggat 10683279  T
108 cagacagattcatggcattgcattgtcaaaattgcaacaaaattcacttgtaaatagtctaaagttttatgttgtataga 187  Q
    ||||||||||||||| |||||||||||||||||| |||||||| | |||||| |||||||||||||||||||||||||||    
10683278 cagacagattcatggtattgcattgtcaaaattggaacaaaatacccttgtagatagtctaaagttttatgttgtataga 10683199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University