View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9243_high_9 (Length: 321)
Name: NF9243_high_9
Description: NF9243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9243_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 8 - 187
Target Start/End: Complemental strand, 10538694 - 10538515
Alignment:
| Q |
8 |
gagaagcagagattgtaatattatactttggactcaatggagagacccctctgtcttttgaagagataggaaagttgttgaaactatcaagggagagaat |
107 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
10538694 |
gagaagaagagattgtaagattatactttggactcaatggagagacccctttgtcttttgaggagataggaaagctgttgaaactatcaagagagagaat |
10538595 |
T |
 |
| Q |
108 |
cagacagattcatggcattgcattgtcaaaattgcaacaaaattcacttgtaaatagtctaaagttttatgttgtataga |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| | ||||| |||||||||||||||||||||| |||| |
|
|
| T |
10538594 |
cagacagattcatggcattgcattgtcaaaattgcgacaaaatactattgtagatagtctaaagttttatgttgtttaga |
10538515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 8 - 187
Target Start/End: Complemental strand, 10683378 - 10683199
Alignment:
| Q |
8 |
gagaagcagagattgtaatattatactttggactcaatggagagacccctctgtcttttgaagagataggaaagttgttgaaactatcaagggagagaat |
107 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |||||||||||||||| ||||| || |
|
|
| T |
10683378 |
gagaagaagagattgtaagattatactttggactcaatggagagacccctttgtcttttgaggagataggaaagctgttgaaactatcaagagagaggat |
10683279 |
T |
 |
| Q |
108 |
cagacagattcatggcattgcattgtcaaaattgcaacaaaattcacttgtaaatagtctaaagttttatgttgtataga |
187 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||| | |||||| ||||||||||||||||||||||||||| |
|
|
| T |
10683278 |
cagacagattcatggtattgcattgtcaaaattggaacaaaatacccttgtagatagtctaaagttttatgttgtataga |
10683199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University