View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9243_low_32 (Length: 241)
Name: NF9243_low_32
Description: NF9243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9243_low_32 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 14 - 241
Target Start/End: Complemental strand, 40942907 - 40942680
Alignment:
| Q |
14 |
tcaggaatctcttaatcatatgaatccttatcagctatattatctttaccatcattcagctgaattgccattttcttttgcttgggttacaccaacttcc |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40942907 |
tcaggaatctcttaatcatacgaatccttatcagctatattatctttaccatcattcagctgaattgccattttcttttgcttgggttacaccaacttcc |
40942808 |
T |
|
| Q |
114 |
gctggccgaataacacgatcatgaagcaaatatcctgcctgcaaacataacagttggatagatttttattcatgttttcaatctcctaaataaacctatc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40942807 |
gctggccgaataacacgatcatgaagcaaatatcctgcctgcaaacataacagttggatagatttttattcatgttttcaatctcctaaataaacctatc |
40942708 |
T |
|
| Q |
214 |
gaacaaaatcgtgaataaggataagttt |
241 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
40942707 |
gaacaaaatcgtgaataaggacaagttt |
40942680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University