View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9245_low_13 (Length: 240)

Name: NF9245_low_13
Description: NF9245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9245_low_13
NF9245_low_13
[»] chr3 (1 HSPs)
chr3 (19-240)||(54380117-54380338)


Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 54380117 - 54380338
Alignment:
19 tacagggcatgtgacagggaaacctggacaagctaccatgacgggtcttccaccaatcagcgcagttcgcttggaacagatgagtaaagcggttcggtgg 118  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54380117 tacagggcatgtggcagggaaacctggacaagctaccatgacgggtcttccaccaatcagcgcagttcgcttggaacagatgagtaaagcggttcggtgg 54380216  T
119 cttgtgattgaattgcagcatggctctggaggacctgctggttcttctagttcagctctttcacatccctcggccccttttgatgccaggttttctgaag 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54380217 cttgtgattgaattgcagcatggctctggaggacctgctggttcttctagttcagctctttcacatccctcggccccttttgatgccaggttttctgaag 54380316  T
219 atgctgctcagtagcatttacc 240  Q
    ||||||||||||||||||||||    
54380317 atgctgctcagtagcatttacc 54380338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University