View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9246_high_17 (Length: 238)
Name: NF9246_high_17
Description: NF9246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9246_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 3 - 202
Target Start/End: Complemental strand, 4191186 - 4190973
Alignment:
| Q |
3 |
aagaatgtgaa-cctgtccttttgctcaatttctcattgctttcttgcattatat-------------tagatccattggtgtgcccattgattattgac |
88 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
4191186 |
aagaatgtgaaacctgtccttttgctcaaattctcattgctttcttgcattatatatgttcataatactagaaccattggtgtgcccattgattattgac |
4191087 |
T |
|
| Q |
89 |
aggtagcgaatttgtttgtgtgctttaaactacttgttttggcgtgcattgcggttgaggtggaaaatgtgggggtgatgaagttgtctttctgatggcg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4191086 |
aggtagcgaatttgtttgtgtgctttaaactacttgttttggcgtgcattgcggttgaggtggaaaatgtgggggtgatgaagttgtctttctgatagcg |
4190987 |
T |
|
| Q |
189 |
ggctttgaggttgt |
202 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4190986 |
ggctttgaggttgt |
4190973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University