View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9247_low_39 (Length: 277)
Name: NF9247_low_39
Description: NF9247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9247_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 19 - 264
Target Start/End: Complemental strand, 1037131 - 1036886
Alignment:
| Q |
19 |
ggtgatcatgatgagaaaaagattcttgaatcaacaaggacaagaatcaaagacatggctttatccactactcaagctgtaaccagttatgcaaagaggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1037131 |
ggtgatcatgatgagaaaaagattcttgaatcaacaaggacaagaatcaaagacatggctctatccactactcaagctgtaaccagttatgcaaagaggt |
1037032 |
T |
 |
| Q |
119 |
tcagtgaagaagataaacaaaagctaatatacactggtgcaacaattcttgtggttgcacttggtgtttatgcttcctacaagtatcgttcttcgcgtag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1037031 |
tcagtgaagaagataaacaaaagctaatatacactggtgcaacaattcttgtggttgcacttggtgtttatgcttcctacaagtatcgttcttcgcgtag |
1036932 |
T |
 |
| Q |
219 |
agcataggcaaatggcatgatctatttcaattgacatggtttctta |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1036931 |
agcataggcaaatggcatgatctatttcaattgacatggtttctta |
1036886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University