View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9247_low_43 (Length: 249)
Name: NF9247_low_43
Description: NF9247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9247_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 30273189 - 30272937
Alignment:
| Q |
1 |
ttattgctgggatcgaatatggaaacatgcatgatttttacaaccattttaaaagagtcaacgttgcaccaactcaggaggaacacgaacttatcaacaa |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30273189 |
ttattgctgggattgaatatggaaacatgcatgatttttacaaccattttaaaagagtcaaagttgcaccaactcaggaggaacacgaacttatcaacaa |
30273090 |
T |
 |
| Q |
101 |
gagagagc------------------aa---tttgtgcaaaccaaagatgacatgaaggtgcagaacaaagaaactgaaattatcaatttggaagaaacc |
179 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30273089 |
gagagagcctagacaagtgcacaggaaagcttttgtgcaaaccaaagatgacatgaaggtgcagaacaaagaaactgaaattatcaatttggaagaaacc |
30272990 |
T |
 |
| Q |
180 |
acttgaaacaataaacaatttcaagggtcctccctatggctctctccctctct |
232 |
Q |
| |
|
| ||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30272989 |
aattgaaacaacaaacaatttcgagggtcctccctatggctctctccctctct |
30272937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 111 - 174
Target Start/End: Complemental strand, 12089226 - 12089163
Alignment:
| Q |
111 |
tttgtgcaaaccaaagatgacatgaaggtgcagaacaaagaaactgaaattatcaatttggaag |
174 |
Q |
| |
|
|||||||||||||||||| ||||||| || || ||||||||||||||||||||||||||||||| |
|
|
| T |
12089226 |
tttgtgcaaaccaaagataacatgaatgtacaaaacaaagaaactgaaattatcaatttggaag |
12089163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 104
Target Start/End: Complemental strand, 12089295 - 12089254
Alignment:
| Q |
63 |
gttgcaccaactcaggaggaacacgaacttatcaacaagaga |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
12089295 |
gttgcaccaactcaggaggaacaagaactgatcaacaagaga |
12089254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University