View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9247_low_45 (Length: 238)
Name: NF9247_low_45
Description: NF9247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9247_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 21083225 - 21083431
Alignment:
| Q |
15 |
cacagacaaatacaacaaaaacattccaatcataggagggtttggacgttcaaccgctcttccttttacacttgcaagcgggaccatcacaaaaaaccac |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21083225 |
cacacacaaatacaacaaaaacattccaatcataggagggtttggacgttcaaccgctcttccttttacacttgcaagcgggaccatcacaaaaaaccac |
21083324 |
T |
|
| Q |
115 |
ccttaaaataaataaaacaaactctcacaactaaaatattatgtgtagagagaatcaataataacaatatcgctctttaacacacacttttcaactgact |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21083325 |
ccttaaaataaataaaacaaactctcacaactaaaatattatgtgtagagagaatcaataataacaatatcgctctttaacacacatttttcaactgact |
21083424 |
T |
|
| Q |
215 |
tctttct |
221 |
Q |
| |
|
||||||| |
|
|
| T |
21083425 |
tctttct |
21083431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University