View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9247_low_49 (Length: 231)
Name: NF9247_low_49
Description: NF9247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9247_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 76 - 214
Target Start/End: Complemental strand, 52002381 - 52002243
Alignment:
| Q |
76 |
gcatccatcaaactaattaaatattttaacacattgtagtagattttgatcaaccaatttagcgcgggaaaacaagaataagaaacagaaaatggaccca |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52002381 |
gcatccatcaaactaattaaatattttaacacattgtagtagattttgatcaaccaatttagcgcgggaaaacaagaataagaaacagaaaatggaccca |
52002282 |
T |
 |
| Q |
176 |
cccaatcccaacgatgcccctcccattgaggatataact |
214 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52002281 |
cccaatcccaacgatgtccctcccattgaggatataact |
52002243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University