View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9248_high_6 (Length: 237)
Name: NF9248_high_6
Description: NF9248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9248_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 122 - 222
Target Start/End: Complemental strand, 28960283 - 28960183
Alignment:
| Q |
122 |
gaactaataccaacaacaactgtaccctgattttgagcaagtaccctgttatactatacttttataataaattaataagaattgataatttaataaattt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28960283 |
gaactaataccaacaacaactgtaccctgattttgagcaagtaccctgttatactatacttttattataaattaataagaattgataatttaataaattt |
28960184 |
T |
|
| Q |
222 |
a |
222 |
Q |
| |
|
| |
|
|
| T |
28960183 |
a |
28960183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 37
Target Start/End: Complemental strand, 28960394 - 28960365
Alignment:
| Q |
8 |
gtttggtgttgaggaagattgttccatgct |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28960394 |
gtttggtgttgaggaagattgttccatgct |
28960365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University