View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9248_high_7 (Length: 211)
Name: NF9248_high_7
Description: NF9248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9248_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 119 - 196
Target Start/End: Original strand, 19962229 - 19962306
Alignment:
| Q |
119 |
tctttccccctaactctttactttcctgcttttgaaatttcttcttttccatggcgtcctcatcctctgtatcaaaaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19962229 |
tctttccccctaactctttactttcctgcttttgaaatttcttcttttccatggcgtcctcatcctctgtatcaaaaa |
19962306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 19962121 - 19962158
Alignment:
| Q |
20 |
agagtgataaggggagtaatgtcgtagtactaatcact |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19962121 |
agagtgataaggggagtaatgtcgtagtactaatcact |
19962158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 196
Target Start/End: Complemental strand, 20028152 - 20028091
Alignment:
| Q |
135 |
tttactttcctgcttttgaaatttcttcttttccatggcgtcctcatcctctgtatcaaaaa |
196 |
Q |
| |
|
|||| |||||| ||||| |||||||||||||||||||||||| |||||||||| | |||||| |
|
|
| T |
20028152 |
tttattttcctacttttcaaatttcttcttttccatggcgtcatcatcctctgcaacaaaaa |
20028091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University