View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9248_low_10 (Length: 305)
Name: NF9248_low_10
Description: NF9248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9248_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 287
Target Start/End: Complemental strand, 6061025 - 6060739
Alignment:
| Q |
1 |
attttgtaaatacacatattagcccctcaagttattcacacaaaaattatcccaactccaatttacattcctgaaatcatggcagaagcagtgattggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6061025 |
attttgtaaatacacatattagcccctcaagttattcacacaaaaattatcccaactccaatttacattcctgaaatcatggcagaagcagtgattggtg |
6060926 |
T |
 |
| Q |
101 |
gagctttcctctctgctttctttgatgttgtcttcaaaaagttgacatcaccagaagttgctaatttgatccttggaaacaaacttgacaagaaattgct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6060925 |
gagctttcctctctgctttctttgatgttgtcttcaaaaggctggcatcacctgaagttgctaatttgatccttggaaacaaacttgacaagaaattgct |
6060826 |
T |
 |
| Q |
201 |
tcagaggctcgagacaactttgagagtggttagagctgtgcttaatgatgctgagaagaaacaaaccagggattctgatgtcaacaa |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6060825 |
tcagaggctcgagacaactttgagagtggttagagctgtgcttaatgatgctgagaagaaacaaaccagggattctgatgtcaacaa |
6060739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University