View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9248_low_14 (Length: 237)

Name: NF9248_low_14
Description: NF9248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9248_low_14
NF9248_low_14
[»] chr4 (2 HSPs)
chr4 (122-222)||(28960183-28960283)
chr4 (8-37)||(28960365-28960394)


Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 122 - 222
Target Start/End: Complemental strand, 28960283 - 28960183
Alignment:
122 gaactaataccaacaacaactgtaccctgattttgagcaagtaccctgttatactatacttttataataaattaataagaattgataatttaataaattt 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
28960283 gaactaataccaacaacaactgtaccctgattttgagcaagtaccctgttatactatacttttattataaattaataagaattgataatttaataaattt 28960184  T
222 a 222  Q
    |    
28960183 a 28960183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 37
Target Start/End: Complemental strand, 28960394 - 28960365
Alignment:
8 gtttggtgttgaggaagattgttccatgct 37  Q
    ||||||||||||||||||||||||||||||    
28960394 gtttggtgttgaggaagattgttccatgct 28960365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University