View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9248_low_17 (Length: 211)

Name: NF9248_low_17
Description: NF9248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9248_low_17
NF9248_low_17
[»] chr3 (3 HSPs)
chr3 (119-196)||(19962229-19962306)
chr3 (20-57)||(19962121-19962158)
chr3 (135-196)||(20028091-20028152)


Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 119 - 196
Target Start/End: Original strand, 19962229 - 19962306
Alignment:
119 tctttccccctaactctttactttcctgcttttgaaatttcttcttttccatggcgtcctcatcctctgtatcaaaaa 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19962229 tctttccccctaactctttactttcctgcttttgaaatttcttcttttccatggcgtcctcatcctctgtatcaaaaa 19962306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 19962121 - 19962158
Alignment:
20 agagtgataaggggagtaatgtcgtagtactaatcact 57  Q
    ||||||||||||||||||||||||||||||||||||||    
19962121 agagtgataaggggagtaatgtcgtagtactaatcact 19962158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 135 - 196
Target Start/End: Complemental strand, 20028152 - 20028091
Alignment:
135 tttactttcctgcttttgaaatttcttcttttccatggcgtcctcatcctctgtatcaaaaa 196  Q
    |||| |||||| ||||| |||||||||||||||||||||||| |||||||||| | ||||||    
20028152 tttattttcctacttttcaaatttcttcttttccatggcgtcatcatcctctgcaacaaaaa 20028091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University