View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9249_low_23 (Length: 274)
Name: NF9249_low_23
Description: NF9249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9249_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 7 - 110
Target Start/End: Original strand, 47036851 - 47036954
Alignment:
| Q |
7 |
ggaggagcagagagcattcacatgacaaccgataaacataactgcatttatcataaatataataccgacatgactctgtaattgtgctcctgattctttt |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47036851 |
ggaggagaagagagcattcacatgacaaccgataaacataactgcatttatcataaatataataccgacatgactctgtaattgtgctcctgattctttt |
47036950 |
T |
|
| Q |
107 |
tcat |
110 |
Q |
| |
|
|||| |
|
|
| T |
47036951 |
tcat |
47036954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 173 - 253
Target Start/End: Original strand, 47037019 - 47037099
Alignment:
| Q |
173 |
tcttgatggtccctactcataaaaaacaaatggaatggtaagctccaaaacactctttgagattgagcactactattcttt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47037019 |
tcttgatggtccctactcataaaaaacaaatggtatggtaagctccaaaacactctttgagattgagcactactattcttt |
47037099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University