View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9249_low_28 (Length: 209)
Name: NF9249_low_28
Description: NF9249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9249_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 29 - 191
Target Start/End: Original strand, 823541 - 823704
Alignment:
| Q |
29 |
attattctcaagaaagggtagcgaatt-gttgtgattggctgttataccatgaccaccatgttttccacttaaaccggaattaaaatcaagatccaacgg |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
823541 |
attattctcaagaaagggtagcgaatttgttgtggttggctgttataccatgaccaccatgttttccacttaaaccggaattaaaaccaagatccaacgg |
823640 |
T |
|
| Q |
128 |
tgcacacgcctcgtgaaatgctcgagacattttttgtgctggggaatagcacttctcttaaatc |
191 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
823641 |
tgcacacgcctcatgaaatgctcgagacattttttgtgccggggaatagcacttctcttaaatc |
823704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 115 - 164
Target Start/End: Original strand, 2287682 - 2287731
Alignment:
| Q |
115 |
caagatccaacggtgcacacgcctcgtgaaatgctcgagacattttttgt |
164 |
Q |
| |
|
|||||||||| |||||||| || |||||||||| ||| |||||||||||| |
|
|
| T |
2287682 |
caagatccaagggtgcacaagcttcgtgaaatgatcgggacattttttgt |
2287731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University