View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9250_high_2 (Length: 333)
Name: NF9250_high_2
Description: NF9250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9250_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 37600423 - 37600236
Alignment:
| Q |
19 |
gaatacacttataaaaaagccttggttttatatgtttttgnnnnnnnnngtctgatctaaactgagttcgtagactataccgtagactcatcaaacttat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| ||||||| | ||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
37600423 |
gaatacacttataaaaaagccttggttttatatgtttttgaaaaaaaa-gtctaatctaaattaagttcgtagactagaccgtagacccatcaaatttat |
37600325 |
T |
|
| Q |
119 |
tctcacccctagttacaagatgcaacaattgataatacattaattttatatttgactttgactttcttctctttctattatgctcttct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37600324 |
tctcacccctagttacaagatgcaacaattgataatacattaattttatatttgactttgactttcttctctttctattatgctcttct |
37600236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 198 - 317
Target Start/End: Complemental strand, 37600207 - 37600088
Alignment:
| Q |
198 |
atgctcttctataatgttgtgatatgtagttcatatacttgttttgaacaatttaggtgtactaagggtttgtatgagtgtttcagaggagtttatgtgt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37600207 |
atgctcttctataatgttgtgatatgtagttcatatacttgttttgaacaatttaggcgtactaagggtttgtatgagtgtttcagtggagtttatgtgt |
37600108 |
T |
|
| Q |
298 |
cgtagcgttttgctagtgat |
317 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
37600107 |
cgtagcgttttgctagtgat |
37600088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University