View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9250_low_16 (Length: 211)
Name: NF9250_low_16
Description: NF9250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9250_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 50424927 - 50424724
Alignment:
| Q |
1 |
ttatttcattgttgtatttgtgtttgtgaaaaaactaattgaagcag-ggtctaacatgtctaacgagtaaagacacgacaagtaggggcgggaattggc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50424927 |
ttatttcattgttgtatttgtgtttgtgaaaaaactaattgaagcagtggtctaacatgtctaa-gagtaaagacacgacaagtaggggcggaaattggc |
50424829 |
T |
|
| Q |
100 |
cgggtcgaaatagtttttgcttaaataggtcatacttagttgnnnnnnnnntaaaacataaatttgacttattagctcgtcaaagactttattttaagta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
50424828 |
cgggtcgaaatagtttttgcttaaataggttatacttagttgaagaaaaa--aaaacataaatttaacttattagttcgtcaaagactttattttaagta |
50424731 |
T |
|
| Q |
200 |
taatcta |
206 |
Q |
| |
|
| ||||| |
|
|
| T |
50424730 |
tgatcta |
50424724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University