View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9251_low_12 (Length: 306)
Name: NF9251_low_12
Description: NF9251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9251_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 106 - 288
Target Start/End: Original strand, 49135317 - 49135499
Alignment:
| Q |
106 |
tacgtacaatcctccactaactcctcttctcactgaaatagactacacctccacccgtcccacccttgctaaaacccgaaatgaacacatccacgaacga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49135317 |
tacgtacaatcctccactaactcctcttctcactgaaatagactacacctccacccgtcccacccttgctaaaacccgaaatgaacacatccacgaacga |
49135416 |
T |
 |
| Q |
206 |
caccttcttattatacccaaaaatatgannnnnnnnnnnaatataattattaatatgatacggttgattatgaatgagattgg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49135417 |
caccttcttattatacccaaaaatatgatctttttttttaatataattattaatatgatacggttgattatgaatgagattgg |
49135499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University