View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9251_low_15 (Length: 252)
Name: NF9251_low_15
Description: NF9251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9251_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 8 - 236
Target Start/End: Original strand, 51845734 - 51845962
Alignment:
| Q |
8 |
aagcagagatatatttgatgccgagatgagacggtttgggaggcttagaaaccgtaatattttggctcctttggcttaccattaccgcagggaggagaag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51845734 |
aagcagagatatatttgatgccgagatgagacggtttgggaggcttagaaaccgtaatattttggctcctttggcttaccattaccgcagggaggagaag |
51845833 |
T |
|
| Q |
108 |
ttatttgttactgaatacatgcctaaaggaagcttgttatatgtcttgcatggtaacgctgtcacattttatttcttttcctttaatgagcttgttctat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51845834 |
ttatttgttactgaatacatgcctaaaggaagcttgttatatgtcttgcatggtaacgctgtcacattttatttcttttcctttaatgagcttgttctat |
51845933 |
T |
|
| Q |
208 |
ctcaaatttggtgcattcatgtgttattt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51845934 |
ctcaaatttggtgcattcatgtgttattt |
51845962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 21 - 162
Target Start/End: Complemental strand, 18628379 - 18628238
Alignment:
| Q |
21 |
tttgatgccgagatgagacggtttgggaggcttagaaaccgtaatattttggctcctttggcttaccattaccgcagggaggagaagttatttgttactg |
120 |
Q |
| |
|
|||||||| |||||||||| |||||||||| ||||| | |||||||||| ||||||||||||| ||||| || | ||||| ||| | |||||||||| |
|
|
| T |
18628379 |
tttgatgctgagatgagacagtttgggaggattagacatgctaatattttgactcctttggcttatcattatcgtcgagaggaaaagctttttgttactg |
18628280 |
T |
|
| Q |
121 |
aatacatgcctaaaggaagcttgttatatgtcttgcatggta |
162 |
Q |
| |
|
| || | |||||||||||||||||||||||||||||| |||| |
|
|
| T |
18628279 |
agtataagcctaaaggaagcttgttatatgtcttgcacggta |
18628238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University