View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9251_low_8 (Length: 337)
Name: NF9251_low_8
Description: NF9251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9251_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 12 - 321
Target Start/End: Complemental strand, 421084 - 420775
Alignment:
| Q |
12 |
agagacatgttggactatgaatggggtaacccatcaaacatcatgcttaccggaaatgaagacaactccggtgcagcagccaccgatcaagcccaccgtc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
421084 |
agagacatgttggactatgaatggggtaacccatcaaacatcatgcttaccggaaatgaagacaactccggtgcagcagccaccgatcaagcccaccgtc |
420985 |
T |
 |
| Q |
112 |
aaatcttcgaccactatgcttctcaagctatgttatccgacaactaccttaacggacctggtggtggacccaccatcgacataaacagtggtgattttac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
420984 |
aaatcttcgaccactatgcttctcaagctatgttatccgacaactaccttaacggacctggtggtggacccaccatcgacataaacagtggtgattttac |
420885 |
T |
 |
| Q |
212 |
tcatcaccacaaccagtttagcccacacgcccagcagcaccataatatccatcagtccttcttcgacccacgggcttttcatggagggtcatcaactgct |
311 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
420884 |
tcatcaccacaaccagtttagcccacacaaccagcagcaccataatatccatcagtccttcttcgacccacgggcttttcatggagggtcatcaactgct |
420785 |
T |
 |
| Q |
312 |
tcttcttacc |
321 |
Q |
| |
|
|||||||||| |
|
|
| T |
420784 |
tcttcttacc |
420775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University