View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9252_high_4 (Length: 202)
Name: NF9252_high_4
Description: NF9252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9252_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 12 - 186
Target Start/End: Original strand, 53693601 - 53693775
Alignment:
| Q |
12 |
tggtgttgaatacttattgcagttgatgctactgcatttctgtttcgagtctcctctgacctgtgaaggaataatccatacagattagaaatttcaaaac |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53693601 |
tggtattgaatacttattgcagttgatgctactgcatttctgtttcgagtctcctctgacctgtgaaggaataatccatacagattagaaatttcaaaac |
53693700 |
T |
 |
| Q |
112 |
atggaaaaccatgataacaatgacaaaatatataggttggtcaggaaccaaaactgtattatgatactgatgatt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53693701 |
atggaaaaccatgataacaatgacaaaatatataggttggtcaggaaccaaaactgtattatgatactgatgatt |
53693775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University