View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9253_low_8 (Length: 221)
Name: NF9253_low_8
Description: NF9253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9253_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 14 - 187
Target Start/End: Complemental strand, 40465819 - 40465651
Alignment:
| Q |
14 |
tggtggtcgacatgtaattgggtaagccaagagcttcatattcttatttttaaagctatttgtttgtatttacggaaaccctagcataatcacattgtgt |
113 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40465819 |
tggtggtcgacatgtaattgggtaagc-aagagcttcatcttctt---tttaaagctatttgtttgtatttacggaaaccctagcataatcacattgtgt |
40465724 |
T |
 |
| Q |
114 |
caccgtgatattgtcaaattttttcgtgattctaaaatgcacgactgctatatatttagttaaattcaactaac |
187 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40465723 |
caccgtgatattgtcaaat-ttttcgtgattctaaaatgcacgactgctatatatttagttaaactcaactaac |
40465651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University